Currently, in the breeding of dairy cattle it has become necessary to screen the herd for genetic abnormalities. In particular, one of the most common is complex vertebral malformation (CVM), which is an autosomal recessive hereditary disease in cattle of Holstein breed. CVM affects the quality of bred animals and is manifested by many undesirable traits such as the birth of offspring with low body weight, anomalies of the cervical and thoracic spine, scoliosis and malformations of the carpal and tarsal joints, heart anomalies, and high mortality during the first day of life or stillborn calves. The disease is caused by a point mutation in nucleotide 559 of the SLC35A3 gene, which replaces guanine (G) with thymine (T) and leads to the loss of the function of the nucleotide sugar carrier protein and causes malformations of the vertebrae. Identification of CVM carriers is carried out using the PCR-PIRA method, which is based on the inclusion of an artificial restriction site in the amplification product using two forward (F(w) 5’ – cacaatttgtaggtctcactgca – 3’, F(cvm) 5’ – cacaatttgtaggtctcaatgca – 3’) and one reverse (R(slc) 5’ – cgatgaaaaaggaaccaaaaggg – 3’) primers containing nucleotide substitutions at the 3’ end. The primers for the CVM allele and for the wild-type allele are complementary to the nucleotide sequence in the region from nucleotides 537 to 554 of the bovine SLC35A3 gene, but both primers have differences of 2 nucleotides at positions 4 and 5 from the 3’ end. The statistics of CVM occurrence in cattle of Holstein breed bred in some countries were analyzed. Thus, in Denmark the frequency of occurrence of animals with the anomaly is 31.0 %, in Poland 24.8 %, in Germany 13.2 %, in Japan 32.5 %, in Sweden 23.0 % and in Turkey it is 0.017 %.
